Journal:

Article Title: Developmental specificity of recruitment of TBP to the TATA box of the human ?-globin gene

doi: 10.1073/pnas.072084499

Figure Lengend Snippet: The in vitro γ-globin gene expression depends upon an intact TATA box and recruitment of TBP. (A) The γTATA binds TBP, and the mutation of the γTATA abrogates the TBP binding. Gel shift assays were carried out as described (20). The mutated TATA box fails to bind TBP (lane 8) and to compete away the TBP binding on the wild-type TATA box (lane 4 and 5). The sequences of the double-stranded oligonucleotides used as probes were: γ TATA box, 5′GGATGAAGAATAAAAGGAAGCACCCT3′; γ mut TATA box, 5′GGATGAAGAGCTAGCGGAAGCACCCT3′. (B) The TATA box mutation abolishes transcription of the γ-globin gene. In vitro RNA transcription assays were performed by using nuclear extracts from MEL or K562 cells. The DNA templates used in the assays were μLCR(−382)Aγ (lanes 1, 3, 4, and 6) and μLCR(−382)Aγ(mut TATA) (lanes 2 and 5). α−Amanitin was added in the assays shown in lanes 3 and 6. (C) In vitro γ-globin gene transcription is inhibited by addition of the TATA box oligonucleotide (lane 2) into the assay system but not by poly(dI-dC) or the oligonucleotide with mutated TATA box. (D) TBP heat inactivation. The plasmid HS2γLuc and HeLa nuclear extract were used for in vitro transcriptions (lane 1). Lane 2: HeLa nuclear extracts were treated at 47°C for 10 min before in vitro transcription assay. Lane 3: purified TFIID (TBP) was added into the heat-treated HeLa nuclear extract.

Article Snippet: Anti-TBP [TFIID(TBP) (SI-1), sc-273], anti transcription factor II B [TFIIB(SI-1), sc-274], anti-Pol II [Pol II(N-20), sc-899], antibodies, and normal rabbit IgG were obtained from Santa Cruz Biotechnology.

Techniques: In Vitro, Expressing, Mutagenesis, Binding Assay, Electrophoretic Mobility Shift Assay, Plasmid Preparation, Transcription Assay, Purification

Journal: The Journal of Biological Chemistry

Article Title: Proteomic study identifies Aurora-A–mediated regulation of alternative splicing through multiple splicing factors

doi: 10.1016/j.jbc.2024.108000

Figure Lengend Snippet: Aurora-A regulates splicing factor activity through phosphorylation. A , phosphorylation of SRSF3 by Aurora-A in vivo . Left panel: Phosphorylation of SRSF3 was analyzed upon Aurora-A inhibition in HeLa cells by Phos-tag gels on the top panel. The Western blot analysis of the SRSF3 is shown in the middle panel. TBP was used as a loading control as shown in the bottom panel. Right panel: Phosphorylation of SRSF3 was analyzed upon overexpression of WT or kinase-dead mutant (T287A, T288A) of Aurora-A in HeLa cells by Phos-tag gels. B , phosphorylation of SR proteins (SRSF1, SRSF3, and SRSF7) by Aurora-A was analyzed by autoradiography on the top panel. GST was used as a negative control. Coomassie staining of purified recombinant GST-tagged SR proteins and Western blot analysis of the HIS-tagged Aurora-A kinase are shown in the bottom two panels. The orange arrowhead indicates the auto-phosphorylation of Aurora-A and the green arrowhead indicates the phosphorylation of substrate (SR proteins). C , phosphorylation of hnRNP proteins (HNRNPC and PTBP1) by Aurora-A was analyzed by autoradiography on the top panel. GST was used as a negative control. Western blots of purified recombinant GST-tagged hnRNP proteins and HIS-tagged Aurora-A kinase are shown in the bottom two panels. The orange arrowhead indicates the auto-phosphorylation of Aurora-A and the green arrowhead indicates the phosphorylation of substrate (hnRNP proteins). GST was used as a negative control. D , RT-PCR assays monitoring endogenous splicing of CLK1 exon 4 in HEK293T upon inhibition of Aurora-A with MLN8237 (2 μM) for 72 h. Since the exon 4 skipped isoform undergoes rapid degradation by nonsense-mediated decay (NMD), cycloheximide (100 μg/ml) was applied for the last four hours to inhibit NMD and monitor splicing changes. PSI values are indicated. Two-tailed unpaired t-tests are applied. E , RT-PCR assays monitoring endogenous splicing of CLK1 exon 4 in HEK293T or HeLa cells upon knockdown of Aurora-A, SRSF3, or both for 72 h. Cycloheximide treatment was performed for the last 4 hours. PSI values are indicated. Two-tailed unpaired t-tests are applied.

Article Snippet: Two micrograms of total cell lysates were incubated with Dynabeads protein G (ThermoFisher Scientific #10004D) bound to 2μg of specific antibodies against SRSF1 (Proteintech, #12929-2-AP), SRSF3 (MBL, #RN080PW), SRSF7 (Proteintech, #11044-1-AP), TBP (Proteintech, 22006-1-AP), or Rabbit IgG (Proteintech, #30000-0-AP) overnight at 4 °C with rotation.

Techniques: Activity Assay, Phospho-proteomics, In Vivo, Inhibition, Western Blot, Control, Over Expression, Mutagenesis, Autoradiography, Negative Control, Staining, Purification, Recombinant, Reverse Transcription Polymerase Chain Reaction, Two Tailed Test, Knockdown

Journal: Frontiers in Pharmacology

Article Title: Specnuezhenide Decreases Interleukin-1β-Induced Inflammation in Rat Chondrocytes and Reduces Joint Destruction in Osteoarthritic Rats

doi: 10.3389/fphar.2018.00700

Figure Lengend Snippet: Effect of SPN on IL-1β-induced nuclear translocation of NF-κB p65 and β-catenin. Nuclear and cytoplasmic extraction reagents were used to prepare nuclear (A) and cytoplasmic (B) extracts. Then, protein levels of β-catenin, NF-κB p65, GAPDH in the cytoplasm, and β-catenin, NF-κB p65, and TBP in the nucleus were assessed by Western blotting. GAPDH was used as an endogenous control in the cytoplasm, whereas TBP worked as an endogenous control in the nucleus ( n = 3 per group). (C) Chondrocytes were pretreated with SPN for 1 h, and then stimulated with IL-1β for 6 h for NF-κb-Luc activity analysis, or 12 h for TCF-LEF RE activity analysis ( n = 5 per group). Significance was calculated by one-way ANOVA with post hoc Tukey’s multiple comparisons test. ∗ p < 0.05, ∗∗∗ p < 0.001 versus the IL-1β+SPN (0 μM) group. # p < 0.05, ## p < 0.01, ### p < 0.001 versus the NC group.

Article Snippet: In the present study, Ab against MMP-3 (rabbit mAb, Abcam, ab52915), MMP-9 (rabbit mAb, Abcam, ab76003), IL-6 (10E5, mouse mAb, Santa Cruz, sc-57315), iNOS (rabbit mAb, Abcam, ab3523), COX2 (D5H5, rabbit mAb, Cell Signaling, #12282), collagen 2 (rabbit mAb, Abcam, ab188570), sox9 (rabbit mAb, Abcam, ab185966), β-catenin (D10A8, rabbit mAb, Cell Signaling, #8480p), non-phospho (active) β-catenin (Ser45) (D2U8Y, rabbit mAb, Cell Signaling, #19807S), NF-κB p65 (C22B4, rabbit mAb, Cell Signaling, #4764S), phosphor-NF-κB p65 (Ser536) (rabbit Ab, Cell Signaling, #3031), β-actin (mouse mAb, Abcam, ab8226), GAPDH (rabbit mAb, Cell Signaling, #5174), and TBP (rabbit Ab, Bosterbio, BA3586-2) were used.

Techniques: Translocation Assay, Extraction, Western Blot, Control, Activity Assay